Information

3.5: Crossing Techniques Used in Classical Genetics - Biology

3.5:  Crossing Techniques Used in Classical Genetics - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Classical Genetics

Not only did Mendel solve the mystery of inheritance as units (genes), he also invented several testing and analysis techniques still used today. Classical genetics is the science of solving biological questions using controlled matings of model organisms. It began with Mendel in 1865 but did not take off until Thomas Morgan began working with fruit flies in 1908. Later, starting with Watson and Crick’s structure of DNA in 1953, classical genetics was joined by molecular genetics, the science of solving biological questions using DNA, RNA, and proteins isolated from organisms. The genetics of DNA cloning began in 1970 with the discovery of restriction enzymes.

True Breeding Lines

Geneticists make use of true breeding lines just as Mendel did (Figure (PageIndex{6})a). These are in-bred populations of plants or animals in which all parents and their offspring (over many generations) have the same phenotypes with respect to a particular trait. True breeding lines are useful, because they are typically assumed to be homozygous for the alleles that affect the trait of interest. When two individuals that are homozygous for the same alleles are crossed, all of their offspring will all also be homozygous. The continuation of such crosses constitutes a true breeding line or strain. A large variety of different strains, each with a different, true breeding character, can be collected and maintained for genetic research.

Monohybrid Crosses

A monohybrid cross is one in which both parents are heterozygous (or a hybrid) for a single (mono) trait. The trait might be petal colour in pea plants (Figure (PageIndex{6})b). Recall from chapter 1 that the generations in a cross are named P (parental), F1 (first filial), F2 (second filial), and so on.

Punnett Squares

Given the genotypes of any two parents, we can predict all of the possible genotypes of the offspring. Furthermore, if we also know the dominance relationships for all of the alleles, we can predict the phenotypes of the offspring. A convenient method for calculating the expected genotypic and phenotypic ratios from a cross was invented by Reginald Punnett. A Punnett square is a matrix in which all of the possible gametes produced by one parent are listed along one axis, and the gametes from the other parent are listed along the other axis. Each possible combination of gametes is listed at the intersection of each row and column. The F1 cross from Figure (PageIndex{6})b would be drawn as in Figure (PageIndex{7}). Punnett squares can also be used to calculate the frequency of offspring. The frequency of each offspring is the frequency of the male gametes multiplied by the frequency of the female gamete.

Figure (PageIndex{7}): A Punnett square showing a monohybrid cross. (Original-Deholos (Fireworks)-CC:AN)

Test Crosses

Knowing the genotypes of an individual is usually an important part of a genetic experiment. However, genotypes cannot be observed directly; they must be inferred based on phenotypes. Because of dominance, it is often not possible to distinguish between a heterozygote and a homozgyote based on phenotype alone (e.g. see the purple-flowered F2 plants in Figure (PageIndex{6})b). To determine the genotype of a specific individual, a test cross can be performed, in which the individual with an uncertain genotype is crossed with an individual that is homozygous recessive for all of the loci being tested.

For example, if you were given a pea plant with purple flowers it might be a homozygote (AA) or a heterozygote (Aa). You could cross this purple-flowered plant to a white-flowered plant as a tester, since you know the genotype of the tester is aa. Depending on the genotype of the purple-flowered parent (Figure (PageIndex{8})), you will observe different phenotypic ratios in the F1 generation. If the purple-flowered parent was a homozgyote, all of the F1 progeny will be purple. If the purple-flowered parent was a heterozygote, the F1 progeny should segregate purple-flowered and white-flowered plants in a 1:1 ratio.

Figure (PageIndex{8}): Punnett Squares showing the two possible outcomes of a test cross. (Original-Deholos (Fireworks)-CC:AN)


Thomas Hunt Morgan

Our editors will review what you’ve submitted and determine whether to revise the article.

Thomas Hunt Morgan, (born Sept. 25, 1866, Lexington, Ky., U.S.—died Dec. 4, 1945, Pasadena, Calif.), American zoologist and geneticist, famous for his experimental research with the fruit fly (Drosophila) by which he established the chromosome theory of heredity. He showed that genes are linked in a series on chromosomes and are responsible for identifiable, hereditary traits. Morgan’s work played a key role in establishing the field of genetics. He received the Nobel Prize for Physiology or Medicine in 1933.


Molecular genetics

Molecular genetics is the study of the molecular structure of DNA, its cellular activities (including its replication), and its influence in determining the overall makeup of an organism. Molecular genetics relies heavily on genetic engineering (recombinant DNA technology), which can be used to modify organisms by adding foreign DNA, thereby forming transgenic organisms. Since the early 1980s, these techniques have been used extensively in basic biological research and are also fundamental to the biotechnology industry, which is devoted to the manufacture of agricultural and medical products. Transgenesis forms the basis of gene therapy, the attempt to cure genetic disease by addition of normally functioning genes from exogenous sources.


1. The Impact of Biotechnology on Plant Agriculture 1
Graham Brookes

1.0 Chapter Summary and Objectives 1

1.0.2 Discussion Questions 1

1.2 Cultivation of Biotechnology (GM) Crops 2

1.3 Why Farmers Use Biotech Crops 4

1.4 GM&rsquos Effects on Crop Production and Farming 7

1.5 How the Adoption of Plant Biotechnology has Impacted the Environment 8

1.5.1 Environmental Impacts from Changes in Insecticide and Herbicide Use 8

1.5.2 Impact on GHG Emissions 11

Life Box 1.1 Norman E. Borlaug 14

Life Box 1.2 Mary-Dell Chilton 15

Life Box 1.3 Robert T. Fraley 17

2. Mendelian Genetics and Plant Reproduction 20
Matthew D. Halfhill and Suzanne I. Warwick

2.0 Chapter Summary and Objectives 20

2.0.2 Discussion Questions 20

2.1 Overview of Genetics 20

2.2.1 Law of Segregation 26

2.2.2 Law of Independent Assortment 26

2.3 Mitosis and Meiosis 27

2.3.4 Cytogenetic Analysis 31

2.3.5 Mendelian Genetics and Biotechnology Summary 32

2.4 Plant Reproductive Biology 32

2.4.1 History of Research in Plant Reproduction 32

2.4.3 Hybridization and Polyploidy 36

2.4.4 Mating Systems and Biotechnology Summary 38

Life Box 2.1 Richard A. Dixon 39

Life Box 2.2 Michael L. Arnold 40

3. Plant Breeding 43
Nicholas A. Tinker and Elroy R. Cober

3.0 Chapter Summary and Objectives 43

3.0.2 Discussion Questions 43

3.2 Central Concepts in Plant Breeding 45

3.2.1 Simple vs. Complex Inheritance 45

3.2.2 Phenotype vs. Genotype 46

3.2.3 Mating Systems, Varieties, Landraces, and Pure Lines 47

3.2.4 Other Topics in Population and Quantitative Genetics 49

3.2.5 The Value of a Plant Variety Depends on Many Traits 51

3.2.6 A Plant Variety Must Be Environmentally Adapted 51

3.2.7 Plant Breeding is a Numbers Game 52

3.2.8 Plant Breeding is an Iterative and Collaborative Process 52

3.2.9 Diversity, Adaptation, and Ideotypes 53

3.2.10 Other Considerations 56

3.3 Objectives in Plant Breeding 56

3.4 Methods of Plant Breeding 57

3.4.1 Methods of Hybridization 58

3.4.2 Self]Pollinated Species 58

3.4.3 Outcrossing Species 63

3.4.4 Clonally Propagated Species 67

3.5 Breeding Enhancements 68

3.5.2 Marker]Assisted Selection 68

Life Box 3.1 Gurdev Singh Khush 72

Life Box 3.2 P. Stephen Baenziger 74

Life Box 3.3 Steven D. Tanksley 75

4. Plant Development and Physiology 78
Glenda E. Gillaspy

4.0 Chapter Summary and Objectives 78

4.0.2 Discussion Questions 78

4.1 Plant Anatomy and Morphology 79

4.2 Embryogenesis and Seed Germination 80

4.2.6 Photomorphogenesis 85

4.3.1 Shoot Apical Meristem 86

4.3.2 Root Apical Meristem and Root Development 88

4.4.2 Leaf Development Patterns 91

4.5.2 Floral Organ Identity and the ABC Model 93

4.6 Hormone Physiology and Signal Transduction 94

4.6.1 Seven Plant Hormones and Their Actions 94

4.6.2 Plant Hormone Signal Transduction 96

Life Box 4.1 Deborah Delmer 100

Life Box 4.2 Natasha Raikhel 102

Life Box 4.3 Brenda S.J. Winkel 103

5. Tissue Culture: The Manipulation of Plant Development 107
Vinitha Cardoza

5.0 Chapter Summary and Objectives 107

5.0.2 Discussion Questions 107

5.2 History of Tissue Culture 108

5.3 Media and Culture Conditions 109

5.3.2 Growth Regulators 110

5.4.2 Surface Sterilization of Explants 112

5.5 Culture Conditions and Vessels 113

5.6 Culture Types and Their Uses 113

5.6.1 Callus and Somatic Embryo Culture 113

5.6.2 Cell Suspension Cultures 117

5.6.3 Anther/Microspore Culture 119

5.6.4 Protoplast Culture 119

5.6.5 Somatic Hybridization 120

5.7 Regeneration Methods of Plants in Culture 121

5.7.2 Somatic Embryogenesis 123

5.10 Problems that can Occur in Tissue Culture 124

5.10.1 Culture Contamination 124

5.10.3 Browning of Explants 124

Life Box 5.1 Glenn Burton Collins 125

Life Box 5.2 Martha S. Wright 127

Life Box 5.3 Vinitha Cardoza 128

6. Molecular Genetics of Gene Expression 133
Maria Gallo and Alison K. Flynn

6.0 Chapter Summary and Objectives 133

6.0.2 Discussion Questions 133

6.1.1 DNA Coding for a Protein via the Gene 133

6.1.2 DNA as a Polynucleotide 134

6.2 DNA Packaging into Eukaryotic Chromosomes 134

6.3.1 Transcription of DNA to Produce Messenger Ribonucleic Acid 135

6.3.2 Transcription Factors 140

6.3.3 Coordinated Regulation of Gene Expression 140

6.3.4 Chromatin as an Important Regulator of Transcription 141

6.3.5 Regulation of Gene Expression by DNA Methylation 142

6.3.6 RNA]Directed Gene Silencing by Small RNAs 143

6.3.7 Processing to Produce Mature mRNA 143

6.4.1 Initiation of Translation 147

6.4.2 Elongation Phase of Translation 147

6.4.3 Translation Termination 147

6.5 Protein Postranslational Modification 147

Life Box 6.1 Maarten Chrispeels 150

Life Box 6.2 David W. Ow 152

7. Plant Systems Biology 155
Wusheng Liu and C. Neal Stewart, Jr.

7.0 Chapter Summary and Objectives 155

7.0.2 Discussion Questions 155

7.2 Defining Plant Systems Biology 157

7.3 Properties of Plant Systems 158

7.4 A Framework of Plant Systems Biology 159

7.4.1 Comprehensive Quantitative Data Sets 160

7.4.4 Exploring Systems and Models Toward Refinement 161

7.5 Disciplines and Enabling Tools of Plant Systems Biology 162

7.5.2 Plant Transcriptomics 166

7.5.4 Plant Metabolomics 170

Life Box 7.1 C. Robin Buell 177

Life Box 7.2 Zhenbiao Yang 178

8. Recombinant DNA, Vector Design, and Construction 181
Mark D. Curtis and David G.J. Mann

8.0 Chapter Summary and Objectives 181

8.0.2 Discussion Questions 181

8.2.1 DNA Vectors for Plant Transformation 188

8.2.2 Components for Efficient Gene Expression in Plants 190

8.3 Greater Demands Lead to Innovation 192

8.3.1 &ldquoModern&rdquo Cloning Strategies 192

8.4.1 Vectors for High]Throughput Functional Analysis 197

8.4.2 Vectors for Gene Down]Regulation Using RNA Interference (RNAi) 199

8.4.3 Expression Vectors 199

8.4.4 Vectors for Promoter Analysis 200

8.4.5 Vectors Derived from Plant Sequences 201

8.4.6 Vectors for Multigenic Traits 203

8.5 Targeted Transgene Insertions 204

Life Box 8.1 Wayne Parrott 206

Life Box 8.2 David Mann 207

9. Genes and Traits of Interest 211
Kenneth L. Korth

9.0 Chapter Summary and Objectives 211

9.0.2 Discussion Questions 211

9.2 Identifying Genes of Interest via Genomics and other Omics Technologies 212

9.3 Traits for Improved Crop Production Using Transgenics 214

9.3.1 Herbicide Resistance 215

9.3.2 Insect Resistance 218

9.3.3 Pathogen Resistance 220

9.3.4 Traits for Improved Products and Food Quality 222

Life Box 9.1 Dennis Gonsalves 227

Life Box 9.2 Ingo Potrykus 229

10. Promoters and Marker Genes 233
Wusheng Liu, Brian Miki and C. Neal Stewart, Jr.

10.0 Chapter Summary and Objectives 233

10.0.2 Discussion Questions 233

10.2.1 Constitutive Promoters 235

10.2.2 Tissue]Specific Promoters 236

10.2.3 Inducible Promoters 237

10.2.4 Synthetic Promoters 239

10.3.1 Selectable Marker Genes 242

10.4 Marker]Free Strategies 250

Life Box 10.1 Fredy Altpeter 255

Life Box 10.2 Taniya Dhillon 257

11. Transgenic Plant Production 262
John J. Finer

11.0 Chapter Summary and Objectives 262

11.0.2 Discussion Questions 262

11.1 Overview of Plant Transformation 263

11.1.2 Basic Components for Successful Gene Transfer to Plant Cells 263

11.2 Agrobacterium Tumefaciens 265

11.2.1 History of Agrobacterium Research 266

11.2.2 Use of the T]DNA Transfer Process for Transformation 268

11.2.3 Optimizing Delivery and Broadening the Taxonomical Range of Targets 269

11.2.4 Strain and Cultivar Compatibility 270

11.2.5 Agroinfiltration 271

11.2.6 Arabidopsis Floral Dip (Clough and Bent 1998) 271

11.3 Particle Bombardment 272

11.3.1 History of Particle Bombardment 272

11.3.2 The Fate of the Introduced DNA into Plant Cells 274

11.3.3 The Power and Problems of Direct DNA Introduction 275

11.3.4 Improvements in the Control of Transgene Expression 276

11.4 Other Methods of Transformation 276

11.4.1 The Need for Additional Technologies 276

11.4.3 Whole Tissue Electroporation 278

11.4.4 Silicon Carbide Whiskers 278

11.4.6 Laser Micropuncture 279

11.4.7 Nanofiber Arrays 279

11.5 The Rush to Publish 280

11.5.1 Controversial Reports of Plant Transformation 280

11.5.2 Criteria to Consider in Judging Novel Plant Transformation Methods 284

11.6 A Look to the Future 286

Life Box 11.1 Ted Klein 286

Life Box 11.2 John Finer 287

Life Box 11.3 Kan Wang 289

12. Analysis of Transgenic Plants 293
C. Neal Stewart, Jr.

12.0 Chapter Summary and Objectives 293

12.0.2 Discussion Questions 293

12.1 Essential Elements of Transgenic Plant Analysis 293

12.2 Assays for Transgenicity, Insert Copy Number, and Segregation 295

12.2.1 Polymerase Chain Reaction 295

12.2.2 Quantitative PCR 295

12.2.3 Southern (DNA) Blot Analysis 296

12.2.4 Segregation Analysis of Progeny 300

12.3 Transgene Expression 301

12.3.1 Transcript Abundance 301

12.3.2 Protein Abundance 302

12.4 Knockdown or Knockout Analysis Rather than Overexpression Analysis 304

12.5 The Relationship Between Molecular Analyses and Phenotype 305

Life Box 12.1 Hong S. Moon 305

Life Box 12.2 Neal Stewart 306

Life Box 12.3 Nancy A. Reichert 308

13. Regulations and Biosafety 311
Alan McHughen

13.0 Chapter Summary and Objectives 311

13.0.2 Discussion Questions 311

13.2 History of Genetic Engineering and Its Regulation 313

13.3 Regulation of GM Plants 315

13.3.1 New Technologies 316

13.3.2 US Regulatory Agencies and Regulations 317

13.3.5 International Perspectives 321

13.4 Regulatory Flaws and Invalid Assumptions 323

13.4.1 Conventional Plant Breeding has Higher Safety than Biotechnology]Derived GM 324

13.4.2 GMOs Should Be Regulated Because They&rsquore GMOs and Un]natural 324

13.4.3 Even though Product Risk is Important, It is Reasonable that Process (GMO) Should Trigger Regulation 324

13.4.4 Since GM Technology is New, It Might Be Hazardous and Should Be Regulated 325

13.4.5 If We Have a Valid Scientific Test, Then It Should Be Used in Regulations 326

13.4.6 Better Safe than Sorry: Overregulation is Better than Underregulation 326

Life Box 13.1 Alan McHughen 328

Life Box 13.2 Raymond D. Shillito 329

14. Field Testing of Transgenic Plants 333
Detlef Bartsch, Achim Gathmann, Christiane Saeglitz and Arti Sinha

14.0 Chapter Summary and Objectives 333

14.0.2 Discussion Questions 333

14.2 Environmental Risk Assessment Process 334

14.2.1 Initial Evaluation (Era Step 1) 334

14.2.2 Problem Formulation (ERA Step 2) 335

14.2.3 Controlled Experiments and Gathering of Information (ERA Step 3) 335

14.2.4 Risk Evaluation (ERA Step 4) 335

14.2.5 Progression through a Tiered Risk Assessment 335

14.3 An Example Risk Assessment: The Case of Bt Maize 336

14.3.1 Effect of Bt Maize Pollen on Nontarget Caterpillars 337

14.3.2 Statistical Analysis and Relevance for Predicting Potential Adverse Effects on Butterflies 339

14.4 Proof of Safety Versus Proof of Hazard 340

14.5 Modeling the Risk Effects on a Greater Scale 340

14.6 Proof of Benefits: Agronomic Performance 341

Life Box 14.1 Tony Shelton 343

Life Box 14.2 Detlef Bartsch 344

15. Intellectual Property in Agricultural Biotechnology: Strategies for Open Access 347
Monica Alandete]Saez, Cecilia Chi]Ham, Gregory Graff, Sara Boettiger and Alan B. Bennett

15.0 Chapter Summary and Objectives 347

15.0.2 Discussion Questions 347

15.1 Intellectual Property and Agricultural Biotechnology 348

15.1.1 What is Intellectual Property? 349

15.1.2 What is a Patent? 349

15.2 The Relationship Between Intellectual Property and Agricultural Research 351

15.3 Patenting Plant Biotechnology: Has an Anti]Commons Developed? 352

15.3.1 Transformation Methods 352

15.3.2 Selectable Markers 353

15.3.4 Subcellular Localization 354

15.3.5 The Importance of Combining IP]Protected Components in Transgenic Crops 355

15.4 What is Freedom to Operate (FTO)? 355

15.4.1 The Importance of FTO 355

15.4.2 FTO Case Study: the Tomato E8 Promoter 356

15.5 Strategies for Open Access 358

Life Box 15.1 Alan Bennett 360

Life Box 15.2 Maud Hinchee 361

16. Why Transgenic Plants Are So Controversial 366
Jennifer Trumbo and Douglas Powell

16.0 Chapter Summary and Objectives 366

16.0.2 Discussion Questions 366

16.1.1 The Frankenstein Backdrop 367

16.1.2 Agricultural Innovations and Questions 367

16.2 Perceptions of Risk 368

16.3 Responses of Fear 370

16.4 Feeding Fear: Case Studies 372

16.4.1 Pusztai&rsquos Potatoes 372

16.4.2 Monarch Butterfly Flap 373

16.5 How Many Benefits are Enough? 373

16.6 Continuing Debates 375

16.6.1 Process vs. Product 375

16.6.3 Environmental Concerns 376

16.7 Business and Control 376

Life Box 16.1 Tony Conner 378

Life Box 16.2 Channapatna S. Prakash 379

17. The Future: Advanced Plant Biotechnology, Genome Editing, and Synthetic Biology 383
Wusheng Liu and C. Neal Stewart, Jr.

17.0 Chapter Summary and Objectives 383

17.0.2 Discussion Questions 383

17.1 Introduction: The Birth of Synthetic Biology 384

17.2 Defining Synthetic Biology for Plants 385

17.2.1 Design Cycles of Synthetic Biology 385

17.2.2 Foundations of Synthetic Biology 387

17.2.3 Components of Plant Synthetic Biology 388

17.3 Enabling Tools for Plant Synthetic Biology 389

17.3.1 Computer]Aided Design 389

17.3.2 Synthetic Promoters 389

17.3.3 Precise Genome Editing 389

17.4 Synthetic Biology Applications in Plants 393

17.4.1 Synthetic Inducible Promoters 394

17.4.2 A Device for Monitoring Auxin]Induced Plant IAA Degradation in Yeast 395

17.4.3 Circuits for Phytosensing of Explosives or Bacterial Pathogens in Transgenic Plants 395


Physiological techniques

Physiological techniques, directed at exploring functional properties or organisms, are also used in genetic investigations. In microorganisms, most genetic variations involve some important cell function. Some strains of one bacterium ( Escherichia coli), for example, are able to synthesize the vitamin thiamin from simple compounds others, which lack an enzyme necessary for this synthesis, cannot survive unless thiamin is already present. The two strains can be distinguished by placing them on a thiamin-free mixture: those that grow have the gene for the enzyme, those that fail to grow do not. The technique also is applied to human cells, since many inherited human abnormalities are caused by a faulty gene that fails to produce a vital enzyme albinism, which results from an inability to produce the pigment melanin in the skin, hair, or iris of the eyes, is an example of an enzyme deficiency in man.


GENETIC MODIFICATION OF MICROBES

Humans have used and genetically modified (GM) microbes for centuries to produce food. Wine, bread, and cheese are common examples of ancient foods, still popular today, that depend on microbial ingredients and activities. Endogenous populations of microbes, particularly bacteria and yeasts, are genetically varied enough to provide sufficiently different traits to allow the development of useful microbial strains through simple selection or induced mutation.

Microorganisms play significant roles in food production. They serve primary and secondary roles in food fermentation and in food spoilage, and they can produce enzymes or other metabolites used in food production and processing. Fermentations can be initiated and conducted completely by the bacterial populations that are endogenous to the raw materials being fermented. However, it is more reliable in terms of uniformity and predictability to intentionally introduce starter cultures to initiate the fermentation and, in some instances, to perform the complete fermentation process. Most fermented products now are prepared this way in industrialized countries.

The types of microorganisms that carry out food fermentations range from bacteria to molds and yeasts, but by far the most widely used organisms are lactic acid bacteria (LAB) and yeasts (Sacchromyces cerevisiae). Traditional genetic modification methods that have been employed—particularly for microbial starter cultures—include selection, mutagenesis, conjugation, and protoplast fusion, the last of which is analogous to somatic hybridization in plant systems.

Before molecular genetics was developed and applied to LAB, the most widely used genetic modification method was chemical- or ultra-violet-induced mutagenesis, followed by an enrichment or selection process for mutants with superior characteristics.

A second traditional approach, conjugation, relies on natural methods of genetic exchange whereby DNA is transferred from one strain to another. Conjugation can occur between LAB strains as well as between LAB and other bacteria (Steenson and Klaenhammer, 1987). Although the resulting strains could conceivably be labeled as recombinant, the fact that this process can occur naturally circumvents application of the GE organism's classification.

A less common, but still useful, method has been to use protoplast fusion to facilitate recombination between two strains with superior but unique characteristics, producing a strain that possesses the desired characteristics of both parents. Protoplast fusion was classically used as a mapping method in bacteria and only recently has been used successfully to produce strains of LAB with desired characteristics (Patnaik et al., 2002). It has, however, been successfully used for some time to generate yeast strains that produce a greater number of biochemical substrates for use in the fermentation process (Pina et al., 1986).

Given the number and combinations of desirable traits in starter culture organisms, producers have remained interested in developing improved starter cultures, using essentially two different approaches. The traditional approach has been to identify endogenous strains with desirable traits by conducting many small-scale fermentations. This type of trial-and-error approach is far from practical because, while productive, low throughput is a limiting factor in the success rate.

The second approach is to produce the desired traits in the laboratory using molecular genetic and genetic engineering techniques. With the burgeoning field of genomics and the public availability of hundreds of fully sequenced bacterial genomes, this approach has become highly attractive and efficient and is favored by industry. Its primary advantage is the precision with which starter culture strains can be engineered.

The most common method used to introduce recombinant DNA into microorganisms is transformation, whereby DNA of interest is introduced directly into recipient cells by making them permeable using chemical agents, enzymes, or electroporation. The first method developed for LAB was plasmid protoplast fusion, in which recipient cells are stripped of walls and subsequently fused with polyethylene glycol, trapping the newly introduced DNA between the cells (Kondo and McKay, 1984).

Electroporation was developed for LAB during the late 1980s and employs electrical currents to create pores in the cell envelope, allowing DNA from other sources to enter (Luchansky et al., 1988). This method is probably the most widely used for research due to its simplicity. However, it lacks efficiency in many different species.

Recombinant DNA also can be introduced into LAB using a technique called transduction, in which a bacteriophage is used to move DNA from one strain into another (Bierkland and Holo, 1993). Unlike transformation, transduction can be fraught with problems that cause deletions within the plasmid (known as transductional shortening that are typically of undefined length).

Microbial transformation is usually simpler and more efficient than transformation in higher organisms, and has been in use longer for the development of commercial strains. Academic research also has been able to scrutinize the molecular genetic effects of transformation in microbes to a much greater extent than it has in higher organisms. Principles gleaned from studies of microbes have proven instrumental in understanding analogous events in the molecular genetics of higher organisms.


Liquid Chromatography Resolves Proteins by Mass, Charge, or Binding Affinity

Liquid chromatography, a third commonly used technique to separate mixtures of proteins, nucleic acids, and other molecules, is based on the principle that molecules dissolved in a solution will interact (bind and dissociate) with a solid surface. If the solution is allowed to flow across the surface, then molecules that interact frequently with the surface will spend more time bound to the surface and thus move more slowly than molecules that interact infrequently with the surface. Liquid chromatography is performed in a column packed tightly with spherical beads. The nature of these beads determines whether separation of proteins depends on differences in mass, charge, or binding affinity.

Gel Filtration Chromatography

Proteins that differ in mass can be separated by gel filtration chromatography. In this technique, the column is composed of porous beads made from polyacrylamide, dextran (a bacterial polysaccharide), or agarose (a seaweed derivative). Proteins flow around the spherical beads in gel filtration chromatography. However, the surface of the beads is punctured by large holes, and proteins will spend some time within these holes. Because smaller proteins can penetrate into the beads more easily than larger proteins, they travel through a gel filtration column more slowly than larger proteins (Figure 3-43a). (In contrast, proteins migrate through the pores in an electrophoretic gel thus smaller proteins move faster than larger ones.) The total volume of liquid required to elute a protein from the column depends on its mass: the smaller the mass, the greater the elution volume. By use of proteins of known mass, the elution volume can be used to estimate the mass of a protein in a mixture.

Figure 3-43

Three commonly used liquid chromatographic techniques. (a) Gel filtration chromatography separates proteins that differ in size. A mixture of proteins is carefully layered on the top of a glass cylinder packed with porous beads. Smaller proteins travel (more. )

Ion-Exchange Chromatography

In a second type of liquid chromatography, called ion-exchange chromatography, proteins are separated based on differences in their charge. This technique makes use of specially modified beads whose surfaces are covered by amino groups or carboxyl groups and thus carry either a positive charge (NH3 + ) or a negative charge (COO − ) at neutral pH.

The proteins in a mixture carry various net charges at any given pH. When a solution of a protein mixture flows through a column of positively charged beads, only proteins with a net negative charge (acidic proteins) adhere to the beads neutral and basic proteins flow unimpeded through the column (Figure 3-43b). The acidic proteins are then eluted selectively by passing a gradient of increasing concentrations of salt through the column. At low salt concentrations, protein molecules and beads are attracted by their opposite charges. At higher salt concentrations, negative salt ions bind to the positively charged beads, displacing the negatively charged proteins. In a gradient of increasing salt concentration, weakly charged proteins are eluted first and highly charged proteins are eluted last. Similarly, a negatively charged column can be used to retain and fractionate positively charged (basic) proteins.

Affinity Chromatography

A third form of chromatography, called affinity chromatography, relies on the ability of a protein to bind specifically to another molecule. Columns are packed with beads to which are covalently attached ligand molecules that bind to the protein of interest. Ligands can be enzyme substrates or other small molecules that bind to specific proteins. In a widely used form of this technique, antibody-affinity chromatography, the attached ligand is an antibody specific for the desired protein (Figure 3-43c). An affinity column will retain only the proteins that bind the ligand attached to the beads the remaining proteins, regardless of their charge or mass, will pass through the column without binding to it. The proteins bound to the affinity column then are eluted by adding an excess of ligand or by changing the salt concentration or pH. Obviously, the ability of this technique to separate particular proteins depends on the selection of appropriate ligands.


MATERIALS AND METHODS

Drosophila

Drosophila melanogaster Meigen were reared on standard medium at 25°C, with a 12 h:12 h ligh:dark photoperiod and 55% relative humidity. Lines used in this study were: wild-type, Canton S white mutants: w 1118 (partial deletion, loss of function: http://flybase.bio.indiana.edu/reports/FBal0018186.html)and w H (hypomorphic allele)(Zachar and Bingham, 1982)tubule principal cell-specific GAL4 driver, c42(Broderick et al., 2004)transgenic w::eYFP lines D4, E5 and H8 (generated for this study).

Mutant w Drosophila (w 1118 and w H ) were `cantonized' by crossing white-eyed flies with isogenized Canton S wild-type flies. The offspring were collected and interbred to produce recessively white-eyed offspring. This process was repeated five times, thus removing 97% of any compensatory mutations that might have accumulated since the mutant stocks were first isolated.

For dissection, flies were anaesthetized by chilling on ice, and decapitated, before removing the tubules in Schneider's medium (Invitrogen Ltd, Paisley, Scotland). All chemicals and drugs were obtained from Sigma(Sigma-Aldrich, Gillingham, Dorset, UK), unless otherwise stated.

Generation of transgenic Drosophila

Over-expression lines containing White tagged with enhanced yellow fluorescent protein (eYFP) at the C terminus were generated as follows:

The coding sequence for eYFP (Clontech UK Ltd, Basingstoke, Hampshire, UK)was amplified using primers that incorporated NotI and KpnI sites at the 5′ and 3′ ends, respectively(GCGGCCGCCATGGTGAGCAAGGGCGAGG/GGTACCCTACTTGTACAGCTCGTCCATGC). The resulting fragment was cloned into the NotI and KpnI sites of pP using standard methods to form pP. The white open reading frame, excluding the stop codon, was PCR amplified from tubule cDNA template using primers:AGATCTATGGGCCAAGAGGATCAGGAG/GCGGCCGCCTCCTTGCGTCGGGCCCGAAG, that incorporated EcoRI and NotI sites at the 5′ and 3′ ends,respectively. This fragment was cloned into pP using the EcoRI and NotI restriction sites to form plasmid pP<w – eYFP-UAST>. The insert was sequenced to check for PCR errors, and the plasmid injected into wDrosophila embryos(w 1118 ) by standard techniques (Vanedis Drosophila injections service, www.vanedis.no). Transformants were selected and maintained using standard Drosophilagenetic techniques.

Fluid transport assays

Fluid transport assays were performed as previously described(Dow et al., 1994b) on intact tubules from Canton S, w 1118 and cantonised w 1118 7-day-old adult flies. Basal rates of fluid transport were established for 30 min, after which 100 μmol l –1 cGMP was added to tubules and fluid transport rates measured for a further 60 min. Data are shown as mean fluid transport rates± s.e.m., N=7.

Cyclic nucleotide transport assays

Transport assays for cGMP and cAMP were based on a modified fluid transport assay transport rates ratios were calculated as previously described(Day et al., 2006). The transport rate provides a linear measure of basal to apical unidirectional flux, whereas a secreted:bathing ratio of >1 indicates that the transport substrate is being concentrated by the tubules(Maddrell et al., 1974). Maximal rates of cGMP and cAMP transport occurred at 100 μmol l –1 (Evans,2007) thus, all transport assays were conducted with a final concentration of 100 μmol l –1 of cyclic nucleotide. The maximal rates of transport of cAMP are significantly higher than that of cGMP:a transport ratio of ∼5 at 100 μmol l –1 cAMP, vs ∼3 for cGMP at 100 μmol l –1 cGMP.

Tubules were dissected into saline (Dow et al., 1994a) and allowed to recover for 30 min prior to addition of cyclic nucleotides: `cold' cGMP or cAMP at 100 μmol l –1 , and tritiated cGMP or cAMP added as tracer (Amersham Pharmacia, Biotech UK Ltd, Amersham, Bucks, UK). Where competitors or drugs were included, these were added 30 min before the radiolabelled substrate. Where the removal of amino acids and citrate was investigated, a minimal Drosophila saline was used(Linton and O'Donnell, 1999)to which the missing ingredients of Drosophila saline(Dow et al., 1994a) were reintroduced at the concentrations normally used.

In all the transport assays, the ratio and rate of transport was measured 1 h after the radiolabelled cyclic nucleotide was added(Evans, 2007). The tubules were allowed to secrete for 1 h before the secreted droplet was measured and removed to Eppendorf tubes containing scintillation fluid (Fisher Scientific,Loughborough, UK). A 1 μl sample of each reservoir droplet was also removed and radioactivity measured in the scintillation counter (Beckman, High Wycombe, UK).

CGMP-dependent kinase bioassay for secreted cGMP

In order to determine if unaltered cGMP is transported through the tubule from the bathing droplet into the lumen, secreted fluid was tested for its ability to stimulate cGMP-dependent protein kinase (cGK) activity in vitro. A secretion assay was carried out with 80 tubules in the standard bathing droplet of Drosophila saline/Schneiders' medium (control) or saline/Schneiders' medium with 100 μmol l –1 cGMP. After allowing the tubules to secrete for 1 h, secreted droplets were pooled (∼2 ml in total), removed from the secretion assay dish and placed into an Eppendorf tube. To remove any residual mineral oil derived from the secretion assay, samples were centrifuged and the oil (top layer) was discarded. A cGK assay was then carried out using the Drosophila cGK, DG2(MacPherson et al., 2004),which had been expressed in S2 cells as a source of DG2 and therefore, cGK activity (MacPherson et al.,2004). Standard kinase reactions were set up in a total volume of 44 μl with 5 μl of DG2 protein sample, 39 μl of kinase assay buffer(MacPherson et al., 2004) and either 1 μl of secreted fluid from control samples or 1 μl of secreted fluid from tubules incubated in 100 μmol l –1 cGMP. Positive controls were set up by adding 1 μl of 100 μmol l –1 cGMP (final concentration 2.2 mmol l –1 )to the assay mix as described above. Three separate experiments were performed for each condition and the results expressed in pmol ATP min –1 mg –1 protein (mean ±s.e.m.).

Real-time quantitative PCR (Q-PCR)

Q-PCR was performed as described previously(McGettigan et al., 2005),using mRNA prepared from tubules from 7-day-old adult Drosophila. Where the effect of cGMP on gene expression was being investigated, tubules were incubated with or without 100 μmol l –1 cGMP in Schneider's medium for 3 h before the mRNA was extracted. Reverse transcription was carried out using Superscript II (Invitrogen) using oligo(dT) primers. For each sample, 500 ng of cDNA was added to 25 μl of SYBR Green reaction mix (Finnzyme, Oy Espoo, Finland) with an appropriate concentration of the primers – WhiteF: GCCACCAAAAATCTGGAGAAGC/WhiteR:CACCCACTTGCGTGAGTTGTTG. Reactions were carried out in an Opticon 2 thermocycler (MJ Research Inc., Waltham, MA, USA). The ribosomal rp49(rpl32) gene (primers rp49F: TGACCATCCGCCCAGCATAC/rp49R:TTCTTGGAGGAGGACGCCGTG) was used as a reference standard in all experiments(McGettigan et al., 2005).

Immunocytochemistry

Immunocytochemistry on intact Malpighian tubules was carried out as previously described (MacPherson et al.,2001). A mouse monoclonal primary anti-GFP antibody recognising GFP variants (Zymed, Invitrogen Ltd) diluted 1:1000 in PAT [0.05% (v/v) Triton X-100 and 0.5% (w/v) BSA in PBS with14 mmol l –1 NaCl, 0.2 mmol l –1 KCl, 1 mmol l –1 Na2HPO4 and 0.2 mmol l –1 KH2PO4, pH 7.4], was used followed by addition of secondary antibody, Alexa Fluor® 568-labelled anti-mouse IgG (Molecular Probes, Invitrogen Ltd), diluted 1:500 in PAT. The nuclear stain 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI) was applied to the tubules for 1 min at 500 ng ml –1 in PBS. Samples were viewed using a Zeiss 510 Meta confocal system and images processed using LMS image software. All images were taken at the same gain and exposure.


DNA Sequencing Example

Though DNA sequencing used to take years, it can now be done in hours. Further, the first full sequence of human DNA took around 3 billion dollars. Now, certain companies will sequence your entire genome for less than $1,000. The most advanced tests will analyze every nucleotide within your genome. However, many companies now offer single-nucleotide polymorphism tests.

There are two main types of DNA sequencing. The older, classical chain termination method is also called the Sanger method. Newer methods that can process a large number of DNA molecules quickly are collectively called High-Throughput Sequencing (HTS) techniques or Next-Generation Sequencing (NGS) methods.

Sanger Sequencing

The Sanger method relies on a primer that binds to a denatured DNA molecule and initiates the synthesis of a single-stranded polynucleotide in the presence of a DNA polymerase enzyme, using the denatured DNA as a template. In most circumstances, the enzyme catalyzes the addition of a nucleotide. A covalent bond, therefore, forms between the 3′ carbon atom of the deoxyribose sugar molecule in one nucleotide and the 5′ carbon atom of the next. This image below shows how this bond is formed.

A sequencing reaction mixture, however, would have a small proportion of modified nucleotides that cannot form this covalent bond due to the absence of a reactive hydroxyl group, giving rise to the term ‘dideoxyribonucleotides’, i.e., they do not have a 2’ or 3’ oxygen atom when compared to the corresponding ribonucleotide. This would terminate the DNA polymerization reaction prematurely. At the end of multiple rounds of such polymerizations, a mixture of molecules of varying lengths would be created.

In the earliest attempts at using the Sanger method, the DNA molecule was first amplified using a labeled primer and then split into four test tubes, each having only one type of ddNTP. That is, each reaction mixture would have only one type of modified nucleotide that could cause chain termination. After the four reactions were completed, the mixture of DNA molecules created by chain termination would undergo electrophoresis on a polyacrylamide gel, and get separated according to their length.

/>
In the image above, a sequencing reaction with ddATP was electrophoresed through the first column. Each line represents a DNA molecule of a particular length, the result of a polymerization reaction that was terminated by the addition of a ddATP nucleotide. The second, third and fourth columns contained ddTTP, ddGTP, and ddCTP respectively.

With time, this method was modified so that each ddNTP had a different fluorescent label. The primer was no longer the source of the radiolabel or fluorescent tag. Also known as dye-terminator sequencing, this method used four dyes with non-overlapping emission spectra, one for each ddNTP.


The image shows the difference between labeled primers, labeled dNTPs and dyed terminator NTPs.


The image above shows a schematic representation of dye-terminator sequencing. There is a single reaction mixture carrying all the elements needed for DNA elongation. The reaction mixture also contains small concentrations of four ddNTPs, each with a different fluorescent tag. The completed reaction is run on a capillary gel. The results are obtained through an analysis of the emission spectra from each DNA band on the gel. A software program then analyzes the spectra and presents the sequence of the DNA molecule.

High Throughput Sequencing

Sanger sequencing continues to be useful for determining the sequences of relatively long stretches of DNA, especially at low volumes. However, it can become expensive and laborious when a large number of molecules need to be sequenced quickly. Ironically, though the traditional dye-terminator method is useful when the DNA molecule is longer, high-throughput methods have become more widely used, especially when entire genomes need to be sequenced.

There are three major changes compared to the Sanger method. The first was the development of a cell-free system for cloning DNA fragments. Traditionally, the stretch of DNA that needed to be sequenced was first cloned into a prokaryotic plasmid and amplified within bacteria before being extracted and purified. High throughput sequencing or next-generation sequencing technologies no longer relied on this labor-intensive and time-intensive procedure.

Secondly, these methods created space to run millions of sequencing reactions in parallel. This was a huge step forward from the initial methods where eight different reaction mixtures were needed to produce a single reliable nucleotide sequence. Finally, there is no separation between the elongation and detection steps. The bases are identified as the sequencing reaction proceeds. While HTS decreased cost and time, their ‘reads’ were relatively short. That is, in order to assemble an entire genome, intense computation is necessary.

The advent of HTS has vastly expanded the applications for genomics. DNA sequencing has now become an integral part of basic science, translational research, medical diagnostics, and forensics.


Chromosomes

Meiosis Label – look at cells in various stages of meiosis, identify and order
Meiosis Internet Lesson – look at animations of meiosis and answer questions
Meiosis Powerpoint – slideshow covers meiosis, homologous chromosomes, crossing over…

Modeling Chromosomal Inheritance – use pipe cleaners to show how genes are inherited independent assortment, segregation, sex-linkage

Linkage Group Simulation – uses pipe cleaners and beads, students construct chromosomes with alleles and perform crosses, predicting outcomes (advanced)
Karyotyping Online – use a website simulator to learn how to pair chromosomes and diagnose abnormalities
Karyotyping Online II – another simulation on how to construct a karyotype
Chromosome Study – cut out chromosomes and tape them in pairs to construct a “paper” karyotype

Gender and Sex Determination – NOVA explores how sex is determined, and social issues of gender

DNA Powerpoint Presentation – covers the basics for a freshman level class

DNA Coloring – basic image of DNA and RNA
DNA Crossword – basic terms

How Can DNA Replication Be Modeled – students use colored paperclips to model how one side of the DNA serves as a template during replication (semi-conservative)

Transcription & Translation Coloring – shows structures involved, nucleotides, base pair rules, amino acids

DNA Analysis: Recombination – simulate DNA recombination using paper slips and sequences
DNA Extraction – instructions for extracting DNA from a strawberry, very simple, works every time!
DNA in Snorks – analyze and transcribe DNA sequences, construct a creature based on that sequence

How DNA Controls the Workings of a Cell – examine a DNA sequence, transcribe and translate
DNA Sequencing in Bacteria – website simulates the sequencing of bacterial DNA, PCR techniques
Ramalian DNA – imagine an alien species that has triple-stranded DNA, base pair rules still apply
Who Ate The Cheese – simulate gel electrophoresis to solve a crime
HIV Coloring – shows how viral DNA enters and infects a cell

Genetic Science Ethics – survey as a group ethical questions involved genetics (cloning, gene therapy..)
Your Genes Your Choices – this is a more involved group assignment where groups read scenarios about genetic testing and ethics involved.
Genetic Engineering Concept Map – Complete this graphic organizer on various techniques used in genetics, such as selective breeding and manipulating DNA

Virtual Labs and Resources

Genetic Engineering – presentation on cloning, recombinant DNA, and gel electrophoresis
Biotechnology Web Lesson – students explore genetic science learning center (https://learn.genetics.utah.edu/) and discover how clones are made, and how DNA is extracted and sequenced
Genetic Science Learning Center – explore website with animations and tutorials, answer questions

DNA From the Beginning -step by step tutorial on the discovery of genes, DNA, and how they control traits, site by Dolan DNA Learning Center
DNA Fingerprinting – another simulation, this one from PBS, that walks you through the steps of creating a DNA Fingerprint
Cloning – Click and Clone at GSLC where you can read about how clones are made and clone your own virtual mouse


Watch the video: Klassische Genetik - Mendelsche Regeln - 3. Regel - Bio - SchulLV Volle Länge (July 2022).


Comments:

  1. Girard

    Your question how to rate?

  2. Arashizshura

    I can recommend going to a site that has a lot of information on this subject.

  3. Elwen

    true helpful post, thanks.

  4. Templeton

    cognitive topic

  5. Blaeey

    I apologize, but it doesn't come my way.

  6. Jeanne

    In all cases.

  7. Isaakios

    some of them are too cute ...

  8. Inachus

    This brilliant phrase will come in handy.



Write a message